Porphyra yezoensis as a model plant for fisheries sciences
نویسندگان
چکیده
منابع مشابه
Preparation and antihypertensive activity of peptides from Porphyra yezoensis
This research was to develop a antihypertensive peptide, an efficient angiotensin converting enzyme (ACE) inhibitor (ACEI), from Porphyra yezoensis. Seven commercial enzymes were screened and then enzymatic hydrolysis conditions were optimised. The results showed that alcalase was the most effective for hydrolysis and its optimum conditions for achieving the highest antihypertensive activity of...
متن کاملAnti-cancer Effects of Polysaccharide and Phycocyanin from Porphyra Yezoensis
In this paper, phycocyanin and one component (PY-D2) in polysaccharide were obtained from Porphyra yezoensis to study for their potential anti-tumor effects. MTT proliferation assays showed that, at concentration of 500 mg/L for 72 h, PY-D2 treatment significantly inhibited the growth of four tumor cell lines, HO-8910, MCF-7, K562 and SMMC-7721, with the respective inhibition rates of 21.2%, 23...
متن کاملCharacterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.
Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملIsolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.
Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: NIPPON SUISAN GAKKAISHI
سال: 2008
ISSN: 1349-998X,0021-5392
DOI: 10.2331/suisan.74.363